Biology Forums - Study Force is the leading provider of online homework help for college and high school students. Get homework help and answers to your toughest questions in biology, chemistry, physics, math, calculus, engineering, accounting, English, writing help, business, humanities, and more. Master your assignments with step-by-step solutions to countless homework questions asked and answered by our members. If we don't have your question, don’t worry. You can ask any homework question and get expert homework help in as little as two hours.
Our extensive online study community is made up of college and high school students, teachers, professors, parents and subject enthusiasts who contribute to our vast collection of study resources: textbook solutions, study guides, practice tests, practice problems, lecture notes, equation sheets and more. With our help, your homework will never be the same!
If you're seeing this message, it means we're having trouble loading external resources on our website.
If you're behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked.
If you're seeing this message, it means we're having trouble loading external resources on our website.
If you're behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked.
4.Which of the following levels of gene expression allows the most rapid response toenvironmental change?
Get answer to your question and much more
5.Extracellular glucose inhibits transcription of the lac operon by ________.
Get answer to your question and much more
6.Imagine you've isolated a yeast mutant that contains a constitutively (constantly) activehistone deacetylase. What phenotype do you predict for this mutant?
Get answer to your question and much more
Upload your study docs or become a
Course Hero member to access this document
Put the following events of elongation in prokaryotic translation in chronological order.
1. Binding of mRNA with small ribosomal subunit
2. Recognition of initiation codon
3. Complementary base pairing between initiator codon and anticodon of initiator tRNA
4. Base pairing of the mRNA codon following the initiator codon with its complementary tRNA
5.
Attachment of the large subunit
2, 1, 4, 3, 5 | ||
5, 4, 3, 2, 1 | ||
1, 2, 3, 5, 4 | ||
1, 2, 3, 4, 5 |
Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…
A: Translation is the process of formation is proteins from the mRNA formed during transcription It…
Q: What are the specific steps of eukaryotic translation? Be sure in your discussion that you include…
A: In transcription, a cell “copies” DNA sequence to a complementary RNA molecule. Then, in…
Q: Use the bank of terms listed to label all important structures of the diagram of the translation…
A: According to the given translation complex diagram, the structures present are 131 - Polypeptide 132…
Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…
A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…
Q: Use the numbers below to indicate the correct order of events (from left to right) during the…
A: Hi, Thanks For Your Question. Answer : Correct Sequence Is 3 4 2 1 5.
Q: Which of the following is NOT an event associated with translation termination? A stop codon…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A terminal amino acid is added to the…
Q: Which of these statements is true about the elongation step of translation? O The growing…
A: ANSWER;- The small ribosomal subunit detaches and reattaches every time a new amino acid is…
Q: Which of these statements is true about the elongation step of translation? The growing polypeptide…
A: Translation: During protein synthesis, translation is the process of converting the sequence of a…
Q: The 5′ region of the TPP riboswitch in Bacillus subtilis is very similar to the TPP riboswitch in E.…
A: Bacterias are genetically regulated by RNA, they use a ribonucleic acid sequence encoded within mRNA…
Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…
A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: What are two advantages for circularizing the mRNA during the process of eukaryotic translation?…
A: Hi, Thanks For Your Question. Answer : Correct Option Is Are mRNA circularization allows for a…
Q: What are two advantages for circularizing the mRNA during the process of eukaryotic translation?…
A: Thank you for the question Answer The two advantages for circularizing the mRNA during the process…
Q: What makes it possible to correctly start translation from an mRNA having multiple codons for…
A: Methionine is the amino acid which codes for AUG codon usually.Translation is the process in which…
Q: The following sequence is from the template strand of a bacterial gene, and it includes the…
A: According to the central dogma of the molecular theory, the information stored in DNA is first…
Q: Which of these statements is true about the elongation step of translation? O The growing…
A: Translation is the process by which the triplet base sequence of an mRNA guides the linking of a…
Q: Methionine is used as the first amino acid for a particular polypeptide, but it is removed during…
A: The synthesis of proteins from the m RNA is called translation.
Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…
A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…
Q: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now…
A: Since you have posted a question with multiple subparts, we will solve the three questions for you.…
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: Which of the following sites would you predict to be present in the gene encoding a MRNA molecule…
A: mRNA known as messenger RNA carries the genetic information that is copied from DNA. mRNA contains…
Q: Initiation of prokaryotic translation begins when the: A. large and small ribosomal subunits link…
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: What is the function of polyadenylation in eukaryotes? (Choose all that apply) It moves ribosomes…
A: Polyadenylation is the addition of a poly (A) tail to a messenger RNA. The poly (A) tail consists of…
Q: What is the function of polyadenylation in eukaryotes? (Choose all that apply) It moves ribosomes…
A: Polyadenylation is the addition of a poly (A) tail to a messenger RNA. The poly (A) tail consists of…
Q: Give an overview of the process of translation in prokaryotes with at least 10 bullet points.
A: Translation: Synthesis of protein from the mRNA. Polypeptide synthesis direction - N - C terminus
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…
A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…
Q: A portion of prokaryotic mRNA has the following base sequence: 5'ACAUCUAUGCCACGA3'. Which of the…
A: The given m RNA sequance will help in synthesis of the protien by the process of Translation .
Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A: Click to see the answer
Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…
A: Option b
Q: The figure below shows a ribosome in the process of translating an mRNA with the sequence:…
A: Codon refers to a sequence of three nucleotides, which codes for start signal, stop signal for…
Q: Why would translation not work if ribosomes could bind only one tRNA at a time?
A: According to the central dogma of the molecular theory, the information stored in the DNA is first…
Q: what is post-translational protein covalent modification? give three examples and name the enzyme…
A: Protein post-translational modifications (PMTs) increase the functional diversity of the proteome by…
Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…
A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…
Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…
A: Translation consists of three main steps: Initiation, Elongation, and Termination. The ribosome is…
Q: Which of the following statements regarding transcription is true? Helicase unwinds the DNA helix to…
A: Transcription is the process of formation of sequence of RNA using DNA as a template and DNA…
Q: A small section of a gene for a protein has the following nucleotide sequence: CTG GGA TCC TAA GGT…
A: A nonsense mutation is one in which the mutation induces the formation of a stop codon which leads…
Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?
A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…
Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…
A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…